After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mensch respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
RSV RSV-F Produktinformation zum cDNA-Klon
Gene_bank_ref_id:
cDNA-Größe:1725bp
cDNA-Beschreibung:Full length Clone DNA of Human RSV (subtype A, strain A2) Fusion glycoprotein / RSV-F with N terminal His tag.
Synonyme für Gene:F, HRSVgp08
Spezies:RSV
Vektor:pCMV3-SP-N-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P03420.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Mensch respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His tag on other vectors
Mensch respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40042-ACG$345
Mensch respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40042-ACR$345
Mensch respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized)VG40042-C$315
Mensch respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, His tagVG40042-C-H$315
Mensch respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40042-CF$315
Mensch respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40042-CH$315
Mensch respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40042-CM$315
Mensch respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40042-CY$315
Mensch respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40042-NF$315
Mensch respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40042-NH$315
Mensch respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40042-NM$315
Mensch respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40042-NY$315
Mensch respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized)VG40042-UT$315
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Hintergrund

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. The G protein mediates attachment of the virus to cell surface receptors, while the F protein promotes fusion of the viral and cellular membranes, allowing entry of the virus ribonucleoprotein into the cell cytoplasm. The fusion (F) protein of RSV is synthesized as a nonfusogenic precursor protein (F0), which during its migration to the cell surface is activated by cleavage into the disulfide-linked F1 and F2 subunits. This fusion is pH independent and occurs directly at the outer cell membrane, and the F2 subunit was identifed as the major determinant of RSV host cell specificity. The trimer of F1-F2 interacts with glycoprotein G at the virion surface. Upon binding of G to heparan sulfate, the hydrophobic fusion peptide is unmasked and induces the fusion between host cell and virion membranes. Notably, RSV fusion protein is unique in that it is able to interact directly with heparan sulfate and therefore is sufficient for virus infection. Furthermore, the fusion protein is also able to trigger p53-dependent apoptosis.

Referenzen
  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 (3): 453-8.
  • Jose A M. et al., 1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73 (8): 6610-7.
  • Zlateva K.T. et al., 2004, J Virol. 78 (9): 4675-83.
  • Trento A. et al., 2006, J Virol. 80 (2): 975-84.
  • Branigan P J. et al., 2006, J Gen Virol. 87 (2): 395-8.
  • Eckardt-Michel J. et al., 2008, J. Virol. 82: 3236-49.
  • Size / Price
    Katalog: VG40042-NH
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“