Neuregulin-1 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

Neuregulin-1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1914 bp
Description
Full length Clone DNA of Human neuregulin 1 transcript variant HRG-beta2.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Neuregulin-1 cDNA ORF Clone, Human, untagged: Alternative Names

ARIA cDNA ORF Clone, Human; GGF cDNA ORF Clone, Human; GGF2 cDNA ORF Clone, Human; HGL cDNA ORF Clone, Human; HRG cDNA ORF Clone, Human; HRG1 cDNA ORF Clone, Human; HRGA cDNA ORF Clone, Human; MST131 cDNA ORF Clone, Human; MSTP131 cDNA ORF Clone, Human; NDF cDNA ORF Clone, Human; Neuregulin 1 cDNA ORF Clone, Human; NRG1-IT2 cDNA ORF Clone, Human; SMDF cDNA ORF Clone, Human

Neuregulin-1 Background Information

Neuregulin 1 or NRG1 is one of four proteins in the neuregulin family that act on the EGFR family of receptors. This growth factor was originally identified as a 44-kD glycoprotein that interacts with the NEU / ERBB2 receptor tyrosine kinase to increase its phosphorylation on tyrosine residues. NRG1 is a trophic factor that has been implicated in neural development, neurotransmission, and synaptic plasticity. NRG1 has multiple isoforms that are generated by usage of different promoters and alternative splicing of a single gene. Neuregulin 1 (NRG1) is essential for the development and function of multiple organ systems, and its dysregulation has been linked to diseases such as cancer and schizophrenia. NRG1 is a schizophrenia candidate gene and plays an important role in brain development and neural function. Schizophrenia is a complex disorder, with etiology likely due to epistasis.
Full Name
neuregulin 1
References
  • Nicodemus KK, et al. (2010) Biological validation of increased schizophrenia risk with NRG1, ERBB4, and AKT1 epistasis via functional neuroimaging in healthy controls. Arch Gen Psychiatry. 67 (10): 991-1001.
  • Tan W, et al. (2007) Molecular cloning of a brain-specific, developmentally regulated neuregulin 1 (NRG1) isoform and identification of a functional promoter variant associated with schizophrenia. J Biol Chem. 282 (33): 24343-51.
  • Holmes WE, et al. (1992) Identification of heregulin, a specific activator of p185erbB2. Science. 256 (5060): 1205-10.

Neuregulin-1 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait