After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mensch VAPB/VAP-B Gene ORF cDNA clone expression plasmid, N-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human VAPB Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_004738.3
cDNA-Größe:732bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens VAMP (vesicle-associated membrane protein)-associated protein B and C with N terminal His tag.
Synonyme für Gene:ALS8, VAP-B, VAP-C, VAMP-B, VAMP-C, VAPB
Spezies:Human
Vektor:pCMV3-N-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Hintergrund

Vesicle-associated membrane protein-associated protein B / C, also known as VAMP-B/VAMP-C, VAMP-associated protein B/C, VAP-B/VAP-C and VAPB, is a single-pass type IV membrane protein which belongs to the VAMP-associated protein ( VAP ) family. VAPB contains one MSP domain. VAPB may play a role in vesicle trafficking. VAPB forms a heterodimer with VAPA. VAPB interacts with VAMP1 and VAMP2. Defects in VAPB are the cause of amyotrophic lateral sclerosis type 8 ( ALS8 ) which is a familial form of amyotrophic lateral sclerosis, a neurodegenerative disorder affecting upper and lower motor neurons and resulting in fatal paralysis. Defects in VAPB are also a cause of spinal muscular atrophy autosomal dominant Finkel type ( SMAF ) which is characterized by proximal muscle weakness that begins in the lower limbs and then progresses to upper limbs.

Referenzen
  • Nishimura Y., et al., 1999, Biochem. Biophys. Res. Commun. 254:21-26.
  • Gevaert K., et al., 2003, Nat. Biotechnol. 21:566-569.
  • Hamamoto I., et al., 2005, J. Virol. 79:13473-13482.
  • Choudhary C. et al., 2009, Science 325:834-840.
  • Size / Price
    Katalog: HG10754-NH
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“