Schnelle Bestellung

Mensch ULK1 Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch ULK1 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_003565.2
cDNA-Größe:3153bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens unc-51-like kinase 1 (C. elegans).
Synonyme für Gene:ATG1, UNC51, Unc51.1, FLJ38455, FLJ46475, ULK1
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ULK1 qPCR primers for gene expression analysis, HP101567 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Katalog: HG12031-UT
Listenpreis: 
Preis:      (You Save: )
Contact Us
Bilder
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“