Tyrosine Hydroxylase cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10684-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Tyrosine Hydroxylase Reagents

CRO Services

Product recommended


All Tyrosine Hydroxylase Reagents

Tyrosine Hydroxylase cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1494 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human tyrosine hydroxylase, transcript variant 2 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (two restriction sites) (6kb + 0.34kb + 1.21kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Tyrosine Hydroxylase cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Tyrosine Hydroxylase cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images

Human TH / Tyrosine Hydroxylase Gene Plasmid Map 5734
Human TH / Tyrosine Hydroxylase Gene Expression validated Image 14371
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

Tyrosine Hydroxylase cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

DYT14 cDNA ORF Clone, Human;DYT5b cDNA ORF Clone, Human;TYH cDNA ORF Clone, Human

Tyrosine Hydroxylase Background Information

Tyrosine hydroxylase (TH) is a rate-limiting enzyme in catecholamine synthesis. Tyrosine hydroxylase activity is modulated by protein-protein interactions with enzymes in the same pathway or the tetrahydrobiopterin pathway, structural proteins considered to be chaperones that mediate the neuron's oxidative state. It is phosphorylated at serine (Ser) residues Ser8, Ser19, Ser31 and Ser4 in vitro. The phosphorylation of tyrosine hydroxylase at Ser19 or Ser8 has no direct effect on tyrosine hydroxylase activity. As tyrosine hydroxylase (TH) catalyses the formation of L-DOPA, the rate-limiting step in the biosynthesis of DA, the Parkinson's disease (PD) can be considered as a TH-deficiency syndrome of the striatum. A direct pathogenetic role of TH has also been suggested, as the enzyme is a source of reactive oxygen species (ROS) in vitro and a target for radical-mediated oxidative injury. Recently, it has been demonstrated that L-DOPA is effectively oxidized by mammalian Tyrosine hydroxylase in vitro, possibly contributing to the cytotoxic effects of DOPA.
Full Name
tyrosine hydroxylase
References
  • Daubner SC, et al. (2011) Tyrosine hydroxylase and regulation of dopamine synthesis. Arch Biochem Biophys. 508(1): 1-12.
  • Dunkley PR, et al. (2004) Tyrosine hydroxylase phosphorylation: regulation and consequences. J Neurochem. 91(5): 1025-43.
  • Haavik J, et al. (1998) Tyrosine hydroxylase and Parkinson's disease. Mol Neurobiol. 16(3): 285-309.
  • Tyrosine Hydroxylase cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Tyrosine Hydroxylase cDNA ORF Clone in Cloning Vector, Mouse MG50997-G
    Tyrosine Hydroxylase cDNA ORF Clone, Mouse, untagged MG50997-UT
    Tyrosine Hydroxylase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50997-ACG
    Tyrosine Hydroxylase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50997-ACGLN
    Tyrosine Hydroxylase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50997-ANG
    Tyrosine Hydroxylase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50997-ACR
    Tyrosine Hydroxylase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50997-ANR
    Tyrosine Hydroxylase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50997-CF
    Tyrosine Hydroxylase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50997-NF
    Tyrosine Hydroxylase cDNA ORF Clone, Mouse, C-His tag MG50997-CH
    Tyrosine Hydroxylase cDNA ORF Clone, Mouse, N-His tag MG50997-NH
    Tyrosine Hydroxylase cDNA ORF Clone, Mouse, C-HA tag MG50997-CY
    Tyrosine Hydroxylase cDNA ORF Clone, Mouse, N-HA tag MG50997-NY
    Tyrosine Hydroxylase cDNA ORF Clone, Mouse, C-Myc tag MG50997-CM
    Tyrosine Hydroxylase cDNA ORF Clone, Mouse, N-Myc tag MG50997-NM
    Tyrosine Hydroxylase qPCR Primer Pairs, Mouse MP200962

    Tyrosine Hydroxylase cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Tyrosine Hydroxylase cDNA ORF Clone in Cloning Vector, Human HG10684-M
    Tyrosine Hydroxylase cDNA ORF Clone, Human, untagged HG10684-UT
    Tyrosine Hydroxylase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10684-ACGLN
    Tyrosine Hydroxylase cDNA ORF Clone, Human, C-GFPSpark® tag HG10684-ACG
    Tyrosine Hydroxylase cDNA ORF Clone, Human, N-GFPSpark® tag HG10684-ANG
    Tyrosine Hydroxylase cDNA ORF Clone, Human, C-OFPSpark® tag HG10684-ACR
    Tyrosine Hydroxylase cDNA ORF Clone, Human, N-OFPSpark® tag HG10684-ANR
    Tyrosine Hydroxylase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10684-NF
    Tyrosine Hydroxylase cDNA ORF Clone, Human, C-His tag HG10684-CH
    Tyrosine Hydroxylase cDNA ORF Clone, Human, N-His tag HG10684-NH
    Tyrosine Hydroxylase cDNA ORF Clone, Human, C-HA tag HG10684-CY
    Tyrosine Hydroxylase cDNA ORF Clone, Human, N-HA tag HG10684-NY
    Tyrosine Hydroxylase cDNA ORF Clone, Human, C-Myc tag HG10684-CM
    Tyrosine Hydroxylase cDNA ORF Clone, Human, N-Myc tag HG10684-NM
    Tyrosine Hydroxylase qPCR Primer Pairs, Human HP100878
    info info
    添加购物车成功! 添加购物车失败!