TM4SF2 / TALLA-1 cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

TM4SF2 / TALLA-1 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
750 bp
Description
Full length Clone DNA of Human tetraspanin 7 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TM4SF2 / TALLA-1 cDNA ORF Clone, Human, N-HA tag: Alternative Names

A15 cDNA ORF Clone, Human; CCG-B7 cDNA ORF Clone, Human; CD231 cDNA ORF Clone, Human; DXS1692E cDNA ORF Clone, Human; MRX58 cDNA ORF Clone, Human; MXS1 cDNA ORF Clone, Human; TALLA-1 cDNA ORF Clone, Human; TM4SF2 cDNA ORF Clone, Human; TM4SF2b cDNA ORF Clone, Human

TM4SF2 / TALLA-1 Background Information

TALLA-1, also known as TSPAN7, is a member of the transmembrane 4 superfamily Most members of this family are cell-surface proteins that are characterized by the presence of four hydrophobic domains. TALLA-1 gene is associated with X-linked mental retardation and neuropsychiatric diseases such as Huntington's chorea, fragile X syndrome and myotonic dystrophy. TALLA-1 is a cell surface glycoprotein and may have a role in the control of neurite outgrowth. It is known to complex with integrins.
Full Name
tetraspanin 7
References
  • Berditchevski F. 2002, J Cell Sci. 114 (23): 4143-51.
  • Castellví-Bel S. et al., 2001, Mol Genet Metab. 72 (2): 104-8.
  • Abidi FE. et al., 2002, J Med Genet. 39 (6): 430-3.
Add to Cart Successfully Add to Cart Failed