Schnelle Bestellung

Mensch c-MPL / CD110 / TPOR Gene ORF cDNA clone expression plasmid, C-His tag

  • Human TPO R ORF mammalian expression plasmid, C-His tag
DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch MPL Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_005373.2
cDNA-Größe:1908bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens myeloproliferative leukemia virus oncogene with C terminal His tag.
Synonyme für Gene:MPLV, TPOR, C-MPL, CD110, MPL
Spezies:Human
Vektor:pCMV3-C-His
Plasmid:pCMV3-MPL-His
Restriktionsschnittstelle:KpnI (two restriction sites) + XbaI (6kb + 0.99kb + 0.98kb)
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with MPL qPCR primers for gene expression analysis, HP100472 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Mensch MPL Gene Plasmid Map
Human TPO R ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Hintergrund

CD110, also known as c-MPL, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs. It is expressed at a low level in a large number of cells of hematopoietic origin. C-MPL is homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. Thrombopoietin is the ligand for c-mpl. It was shown to be the major regulator of megakaryocytopoiesis and platelet formation. Defects in c-MPL are a cause of congenital amegakaryocytic thrombocytopeniawhich is a disease characterized by isolated thrombocytopenia and megakaryocytopenia with no physical anomalies. Defects in c-MPL also cause thrombocythemia type 2 and myelofibrosis with myeloid metaplasia.

Size / Price
Katalog: HG10443-CH
Listenpreis: 
Preis:      (You Save: )

Datasheet & Documentation

Contact Us
    Kürzlich angesehene Artikel
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“