Schnelle Bestellung

Mensch TNFSF18 Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Mensch TNFSF18 Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:NM_005092.3
    cDNA-Größe:600bp
    cDNA-Beschreibung:Full length Clone DNA of Homo sapiens tumor necrosis factor (ligand) superfamily, member 18 with N terminal Myc tag.
    Synonyme für Gene:TL6, AITRL, GITRL, hGITRL
    Spezies:Human
    Vektor:pCMV3-SP-N-Myc
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TNFSF18 qPCR primers for gene expression analysis, HP104622 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Hintergrund

    The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for receptor TNFRSF18/AITR/GITR. It has been shown to modulate T lymphocyte survival in peripheral tissues. This cytokine is also found to be expressed in endothelial cells, and is thought to be important for interaction between T lymphocytes and endothelial cells.

    Immune Checkpoint
    Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

    Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Referenzen
  • Liu Y, Tang X, Tian J, et al. Th17/Treg Cells Imbalance and GITRL Profile in Patients with Hashimoto’s Thyroiditis. Nicot C, ed. International Journal of Molecular Sciences. 2014;15(12):21674-21686.
  • Size / Price
    Katalog: HG16080-NM
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“