TMOD2 cDNA ORF Clone, Human, N-His tag

Cat: HG15256-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All TMOD2 Reagents

CRO Services

Product recommended


All TMOD2 Reagents

TMOD2 cDNA ORF Clone, Human, N-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1056 bp
Description
Full length Clone DNA of Human tropomodulin 2 (neuronal) with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMOD2 cDNA ORF Clone, Human, N-His tag Alternative Names

N-TMOD cDNA ORF Clone, Human;NTMOD cDNA ORF Clone, Human

TMOD2 Background Information

Full Name
tropomodulin 2 (neuronal)

TMOD2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMOD2 cDNA ORF Clone in Cloning Vector, Mouse MG52019-G
TMOD2 cDNA ORF Clone, Mouse, untagged MG52019-UT
TMOD2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52019-ACG
TMOD2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52019-ACGLN
TMOD2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52019-ANG
TMOD2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52019-ACR
TMOD2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52019-ANR
TMOD2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52019-CF
TMOD2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52019-NF
TMOD2 cDNA ORF Clone, Mouse, C-His tag MG52019-CH
TMOD2 cDNA ORF Clone, Mouse, N-His tag MG52019-NH
TMOD2 cDNA ORF Clone, Mouse, C-HA tag MG52019-CY
TMOD2 cDNA ORF Clone, Mouse, N-HA tag MG52019-NY
TMOD2 cDNA ORF Clone, Mouse, C-Myc tag MG52019-CM
TMOD2 cDNA ORF Clone, Mouse, N-Myc tag MG52019-NM
TMOD2 qPCR Primer Pairs, Mouse MP201892

TMOD2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMOD2 cDNA ORF Clone in Cloning Vector, Human HG15256-G
TMOD2 cDNA ORF Clone, Human, untagged HG15256-UT
TMOD2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15256-ACG
TMOD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15256-ACGLN
TMOD2 cDNA ORF Clone, Human, N-GFPSpark® tag HG15256-ANG
TMOD2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15256-ACR
TMOD2 cDNA ORF Clone, Human, N-OFPSpark® tag HG15256-ANR
TMOD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15256-CF
TMOD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15256-NF
TMOD2 cDNA ORF Clone, Human, C-His tag HG15256-CH
TMOD2 cDNA ORF Clone, Human, C-HA tag HG15256-CY
TMOD2 cDNA ORF Clone, Human, N-HA tag HG15256-NY
TMOD2 cDNA ORF Clone, Human, C-Myc tag HG15256-CM
TMOD2 cDNA ORF Clone, Human, N-Myc tag HG15256-NM
TMOD2 qPCR Primer Pairs, Human HP103882
info info
添加购物车成功! 添加购物车失败!