After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mensch TBCB Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human TBCB Produktinformation zum cDNA-Klon
Gene_bank_ref_id:BC005969
cDNA-Größe:735bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens tubulin folding cofactor B.
Synonyme für Gene:CG22, CKAP1, CKAPI, MGC14625
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Hintergrund

Tubulin-folding cofactor B, also known as TBCB, belongs to the TBCB family. It contains 1 CAP-Gly domain and can be detected in most tissues. TBCB binds to alpha-tubulin folding intermediates after their interaction with cytosolic chaperonin in the pathway. The cytoskeleton is composed of 3 structural elements: actin filaments, microtubules, and intermediate filaments. TBCB is involved in regulation of tubulin heterodimer dissociation. It may function as a negative regulator of axonal growth.

Referenzen
  • Feingold EA, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Tian G, et al. (1997) Tubulin subunits exist in an activated conformational state generated and maintained by protein cofactors. J Cell Biol. 138(4):821-32.
  • Wolz W, et al. (1997) A complex satellite DNA polymorphism flanking the human ryanodine receptor gene (RYR1). Cytogenet Cell Genet. 72(2-3):215-6.
  • Size / Price
    Katalog: HG14260-UT
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“