Antithrombin III cDNA ORF Clone, Human, N-Myc tag

Cat: HG10142-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Antithrombin III Reagents
CRO Services
Product recommended

All Antithrombin III Reagents
Antithrombin III cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1395 bp
Description
Full length Clone DNA of Human serpin peptidase inhibitor, clade C (antithrombin), member 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Antithrombin III cDNA ORF Clone, Human, N-Myc tag Alternative Names
AT3 cDNA ORF Clone, Human;AT3D cDNA ORF Clone, Human;ATIII cDNA ORF Clone, Human;MGC22579 cDNA ORF Clone, Human;SerpinC1 cDNA ORF Clone, Human;THPH7 cDNA ORF Clone, Human
Antithrombin III Background Information

SerpinC1, also known as antithrombin III (AT III), is a member of the serpin superfamily of serine protease inhibitors, and has been found to be a marker for disseminated intravascular coagulation (DIC) and to be of prognostic significance in septic patients. SerpinC1 synthesized in the liver is the principal plasma serpin of blood coagulation proteases and inhibits thrombin and other factors such as Xa by the formation of covalently linked complexes. Thus it is one of the most important coagulation inhibitors and the fundamental enzyme for the therapeutical action of heparin. In common with SerpinA5 and D1, the inhibitory activity of SerpinC1 undergoes a dramatic increase in the presence of heparin and other glycosaminoglycans. ATIII mediates the promotion of prostaglandin release, an inhibitor of leucocyte activation and downregulator of many proinflammatory cytokines. Antithrombin III exerts anti-inflammatory properties in addition to its anti-coagulative mechanisms. In animal models of sepsis, ATIII affected cytokine plasma concentrations with a decrease of pro-inflammatory cytokines. The deficiency or functional abnormality of ATIII may result in an increased risk of thromboembolic disease, such as deep vein thrombosis and pulmonary embolism. In addition, it has been reported that SerpinC1 can alter or influence inflammatory processes via inhibition of NF-κB activation or actin polymerization.

Full Name
serpin peptidase inhibitor, clade C (antithrombin), member 1
References
  • de Sousa JC, et al. (1991) Antithrombin III. Physiologic, physiopathologic and laboratory aspects. Rev Port Cardiol. 10(9): 693-9.
  • Totzke G, et al. (2001) Antithrombin III enhances inducible nitric oxide synthase gene expression in vascular smooth muscle cells. Cell Immunol. 208(1): 1-8.
  • Ostermann H. (2002) Antithrombin III in Sepsis. New evidences and open questions. Minerva Anestesiol. 68(5): 445-8.
  • Caglikulekci M, et al. (2004) Effect of antithrombin-III (AT-III) on intestinal epithelium changes related to obstructive icterus: experimental study in rats. Ann Chir. 129(5): 273-7.
  • Antithrombin III cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Antithrombin III cDNA ORF Clone in Cloning Vector, Rat RG80654-U
    Antithrombin III cDNA ORF Clone, Rat, untagged RG80654-UT
    Antithrombin III cDNA ORF Clone, Rat, C-GFPSpark® tag RG80654-ACG
    Antithrombin III Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80654-ACGLN
    Antithrombin III cDNA ORF Clone, Rat, C-OFPSpark® tag RG80654-ACR
    Antithrombin III cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80654-CF
    Antithrombin III cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80654-NF
    Antithrombin III cDNA ORF Clone, Rat, C-His tag RG80654-CH
    Antithrombin III cDNA ORF Clone, Rat, N-His tag RG80654-NH
    Antithrombin III cDNA ORF Clone, Rat, C-HA tag RG80654-CY
    Antithrombin III cDNA ORF Clone, Rat, N-HA tag RG80654-NY
    Antithrombin III cDNA ORF Clone, Rat, C-Myc tag RG80654-CM
    Antithrombin III cDNA ORF Clone, Rat, N-Myc tag RG80654-NM
    Antithrombin III qPCR Primer Pairs, Rat RP300618

    Antithrombin III cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Antithrombin III cDNA ORF Clone in Cloning Vector, Mouse MG52927-G
    Antithrombin III cDNA ORF Clone, Mouse, untagged MG52927-UT
    Antithrombin III cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52927-ACG
    Antithrombin III Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52927-ACGLN
    Antithrombin III cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52927-ANG
    Antithrombin III cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52927-ACR
    Antithrombin III cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52927-ANR
    Antithrombin III cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52927-CF
    Antithrombin III cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52927-NF
    Antithrombin III cDNA ORF Clone, Mouse, C-His tag MG52927-CH
    Antithrombin III cDNA ORF Clone, Mouse, N-His tag MG52927-NH
    Antithrombin III cDNA ORF Clone, Mouse, C-HA tag MG52927-CY
    Antithrombin III cDNA ORF Clone, Mouse, N-HA tag MG52927-NY
    Antithrombin III cDNA ORF Clone, Mouse, C-Myc tag MG52927-CM
    Antithrombin III cDNA ORF Clone, Mouse, N-Myc tag MG52927-NM

    Antithrombin III cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Antithrombin III cDNA ORF Clone in Cloning Vector, Human HG10142-M
    Antithrombin III cDNA ORF Clone, Human, untagged HG10142-UT
    Antithrombin III cDNA ORF Clone, Human, C-GFPSpark® tag HG10142-ACG
    Antithrombin III Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10142-ACGLN
    Antithrombin III cDNA ORF Clone, Human, C-OFPSpark® tag HG10142-ACR
    Antithrombin III cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10142-CF
    Antithrombin III cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10142-NF
    Antithrombin III cDNA ORF Clone, Human, C-His tag HG10142-CH
    Antithrombin III cDNA ORF Clone, Human, N-His tag HG10142-NH
    Antithrombin III cDNA ORF Clone, Human, C-HA tag HG10142-CY
    Antithrombin III cDNA ORF Clone, Human, N-HA tag HG10142-NY
    Antithrombin III cDNA ORF Clone, Human, C-Myc tag HG10142-CM
    Antithrombin III qPCR Primer Pairs, Human HP100213
    info info
    添加购物车成功! 添加购物车失败!