SUMO1 cDNA ORF Clone, Human, C-His tag

Cat: HG13095-CH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All SUMO1 Reagents

CRO Services

Product recommended


All SUMO1 Reagents

SUMO1 cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
351 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human small ubiquitin-like modifier 1 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.35kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SUMO1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SUMO1 cDNA ORF Clone, Human, C-His tag Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5610

SUMO1 cDNA ORF Clone, Human, C-His tag Alternative Names

DAP1 cDNA ORF Clone, Human;GMP1 cDNA ORF Clone, Human;OFC10 cDNA ORF Clone, Human;PIC1 cDNA ORF Clone, Human;SENP2 cDNA ORF Clone, Human;SMT3 cDNA ORF Clone, Human;SMT3C cDNA ORF Clone, Human;SMT3H3 cDNA ORF Clone, Human;UBL1 cDNA ORF Clone, Human

SUMO1 Background Information

Small ubiquitin-like modifier protein (SUMO) modification is a highly dynamic process, catalyzed by SUMO-specific activating (E1), conjugating (E2) and ligating (E3) enzymes, and reversed by a family of SUMO-specific proteases (SENPs). Small ubiquitin-like modifier 1 (SUMO1) is a member of the superfamily of ubiquitin-like proteins. Despite its structural similarity with ubiquitin, SUMO1 does not seem to play any role in protein degradation. SUMO1 plays an important role in modulation of NOX activity required for ROS generation. SUMO1 haploinsufficiency results in cleft lip and palate in animal models. SUMO1 gene variation in human non-syndromic cleft lip with or without cleft palate (NSCLP) development. SUMO-1 may be useful as a novel target for therapy in oral squamous cell carcinoma (SCC) as well as a clinical indicator for tumor recurrence together with Mdm2.
Full Name
small ubiquitin-like modifier 1
References
  • Kim HJ, et al. (2011) SUMO1 attenuates stress-induced ROS generation by inhibiting NADPH oxidase 2. Biochem Biophys Res Commun. 410(3): 555-62.
  • Zuo Y, et al. (2009) Small ubiquitin-like modifier protein-specific protease 1 and prostate cancer. Asian J Androl. 11(1): 36-8.
  • Song T, et al. (2008) SUMO1 polymorphisms are associated with non-syndromic cleft lip with or without cleft palate. Biochem Biophys Res Commun. 377(4): 1265-8.
  • Katayama A, et al. (2007) Overexpression of small ubiquitin-related modifier-1 and sumoylated Mdm2 in oral squamous cell carcinoma: possible involvement in tumor proliferation and prognosis. Int J Oncol. 31(3): 517-24.
  • SUMO1 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    SUMO1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90733-G
    SUMO1 cDNA ORF Clone, Cynomolgus, untagged CG90733-UT
    SUMO1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90733-ACG
    SUMO1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90733-ACGLN
    SUMO1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90733-ANG
    SUMO1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90733-ACR
    SUMO1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90733-ANR
    SUMO1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90733-CF
    SUMO1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90733-NF
    SUMO1 cDNA ORF Clone, Cynomolgus, C-His tag CG90733-CH
    SUMO1 cDNA ORF Clone, Cynomolgus, N-His tag CG90733-NH
    SUMO1 cDNA ORF Clone, Cynomolgus, C-HA tag CG90733-CY
    SUMO1 cDNA ORF Clone, Cynomolgus, N-HA tag CG90733-NY
    SUMO1 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90733-CM
    SUMO1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90733-NM

    SUMO1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    SUMO1 cDNA ORF Clone in Cloning Vector, Rat RG80486-U
    SUMO1 cDNA ORF Clone, Rat, untagged RG80486-UT
    SUMO1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80486-ACG
    SUMO1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80486-ACGLN
    SUMO1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80486-ANG
    SUMO1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80486-ACR
    SUMO1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80486-ANR
    SUMO1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80486-CF
    SUMO1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80486-NF
    SUMO1 cDNA ORF Clone, Rat, C-His tag RG80486-CH
    SUMO1 cDNA ORF Clone, Rat, N-His tag RG80486-NH
    SUMO1 cDNA ORF Clone, Rat, C-HA tag RG80486-CY
    SUMO1 cDNA ORF Clone, Rat, N-HA tag RG80486-NY
    SUMO1 cDNA ORF Clone, Rat, C-Myc tag RG80486-CM
    SUMO1 cDNA ORF Clone, Rat, N-Myc tag RG80486-NM
    SUMO1 qPCR Primer Pairs, Rat RP300450

    SUMO1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SUMO1 cDNA ORF Clone in Cloning Vector, Mouse MG53059-G
    SUMO1 cDNA ORF Clone, Mouse, untagged MG53059-UT
    SUMO1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53059-ACGLN
    SUMO1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53059-ACG
    SUMO1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53059-ANG
    SUMO1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53059-ACR
    SUMO1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53059-ANR
    SUMO1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53059-CF
    SUMO1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53059-NF
    SUMO1 cDNA ORF Clone, Mouse, C-His tag MG53059-CH
    SUMO1 cDNA ORF Clone, Mouse, N-His tag MG53059-NH
    SUMO1 cDNA ORF Clone, Mouse, C-HA tag MG53059-CY
    SUMO1 cDNA ORF Clone, Mouse, N-HA tag MG53059-NY
    SUMO1 cDNA ORF Clone, Mouse, C-Myc tag MG53059-CM
    SUMO1 cDNA ORF Clone, Mouse, N-Myc tag MG53059-NM

    SUMO1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SUMO1 cDNA ORF Clone in Cloning Vector, Human HG13095-G
    SUMO1 cDNA ORF Clone, Human, untagged HG13095-UT
    SUMO1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13095-ACG
    SUMO1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13095-ACGLN
    SUMO1 cDNA ORF Clone, Human, N-GFPSpark® tag HG13095-ANG
    SUMO1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13095-ACR
    SUMO1 cDNA ORF Clone, Human, N-OFPSpark® tag HG13095-ANR
    SUMO1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13095-CF
    SUMO1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13095-NF
    SUMO1 cDNA ORF Clone, Human, N-His tag HG13095-NH
    SUMO1 cDNA ORF Clone, Human, C-HA tag HG13095-CY
    SUMO1 cDNA ORF Clone, Human, N-HA tag HG13095-NY
    SUMO1 cDNA ORF Clone, Human, C-Myc tag HG13095-CM
    SUMO1 cDNA ORF Clone, Human, N-Myc tag HG13095-NM
    SUMO1 qPCR Primer Pairs, Human HP104909
    info info
    添加购物车成功! 添加购物车失败!