After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mensch STC2 Gene ORF cDNA clone expression plasmid, N-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human STC2 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:BC000658
cDNA-Größe:909bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens stanniocalcin 2 with N terminal His tag.
Synonyme für Gene:STC-2, STCRP, STC2
Spezies:Human
Vektor:pCMV3-SP-N-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Hintergrund

STC2 is a secreted, homodimeric glycoprotein which expressed in a wide variety of tissues. STC2 has an anti-hypocalcemic action on calcium and phosphate homeostasis. It may have autocrine or paracrine functions. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. STC2 has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. It may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis.

Referenzen
  • Chang AC, et al. (1998) Identification of a second stanniocalcin cDNA in mouse and human: stanniocalcin 2. Mol Cell Endocrinol. 141(1-2):95-9.
  • Ishibashi K, et al. (1998) Molecular cloning of a second human stanniocalcin homologue (STC2). Biochem Biophys Res Commun. 250(2):252-8.
  • uo CW, et al. (2005) Identification of a stanniocalcin paralog, stanniocalcin-2, in fish and the paracrine actions of stanniocalcin-2 in the mammalian ovary. Endocrinology. 146(1):469-76.
  • Size / Price
    Katalog: HG13653-NH
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“