Schnelle Bestellung

Mensch SRP9 Gene ORF cDNA clone expression plasmid

  • other Green fluorescent protein / GFP Gene Plasmid Map 5613
DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch SRP9 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_003133.5
cDNA-Größe:261bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens signal recognition particle 9kDa.
Synonyme für Gene:ALURBP
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:pCMV3-SRP9-t2
Restriktionsschnittstelle:KpnI + XbaI(6kb+0.26kb)
Tag-Sequenz:
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with SRP9 qPCR primers for gene expression analysis, HP104934 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Katalog: HG16165-UT
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
VerfügbarkeitIn Stock
Zum Einkaufswagen hinzufügenAnfrage zu Großauftrag

Datasheet & Documentation

Contact Us
    Kürzlich angesehene Artikel
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“