After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mensch SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human ATL1 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_015915.4
cDNA-Größe:1677bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens atlastin GTPase 1 , transcript variant 1 with N terminal HA tag.
Synonyme für Gene:FSP1, GBP3, SPG3, SPG3A, AD-FSP, atlastin1
Spezies:Human
Vektor:pCMV3-N-HA
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Mensch SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tag on other vectors
Mensch SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10523-ACG$245
Mensch SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10523-ACR$245
Mensch SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10523-ANG$245
Mensch SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10523-ANR$245
Mensch SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10523-CF$215
Mensch SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10523-CH$215
Mensch SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10523-CM$215
Mensch SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10523-CY$215
Mensch SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10523-M$75
Mensch SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10523-M-F$215
Mensch SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10523-NF$215
Mensch SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10523-NH$215
Mensch SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10523-NM$215
Mensch SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10523-NY$215
Mensch SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10523-UT$215
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Hintergrund

Atlastin-1, also known as Spastic paraplegia 3 protein A, Guanine nucleotide-binding protein 3, GTP-binding protein 3, GBP3, ATL1 and SPG3A, is a multi-pass membrane protein which belongs to the GBP family and atlastin subfamily. ATL1 / SPG3A is expressed predominantly in the adult and fetal central nervous system. Expression of ATL1 / SPG3A in adult brain is at least 50-fold higher than in other tissues. ATL1 / SPG3A is detected predominantly in pyramidal neurons in the cerebral cortex and the hippocampus of the brain. ATL1 / SPG3A is also expressed in upper and lower motor neurons (at protein level). A distinguishing feature of ATL1 / SPG3A is its frequent early onset, raising the possibility that developmental abnormalities may be involved in its pathogenesis. Missense SPG3A mutant atlastin-1 proteins have impaired GTPase activity and may act in a dominant-negative, loss-of-function manner by forming mixed oligomers with wild-type atlastin-1. Defects in ATL1 / SPG3A are the cause of spastic paraplegia autosomal dominant type 3 (SPG3), also known as Strumpell-Lorrain syndrome. Spastic paraplegia is a degenerative spinal cord disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs.

Size / Price
Katalog: HG10523-NY
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
Verfügbarkeit2-3 weeks
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
Contact Us
Bilder
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“