SOCS3 cDNA ORF Clone, Human, C-HA tag

Cat: HG11315-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All SOCS3 Reagents

CRO Services

Product recommended


All SOCS3 Reagents

SOCS3 cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
677 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human suppressor of cytokine signaling 3 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.72kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SOCS3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SOCS3 cDNA ORF Clone, Human, C-HA tag Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5612

SOCS3 cDNA ORF Clone, Human, C-HA tag Alternative Names

ATOD4 cDNA ORF Clone, Human;CIS3 cDNA ORF Clone, Human;Cish3 cDNA ORF Clone, Human;SOCS-3 cDNA ORF Clone, Human;SSI-3 cDNA ORF Clone, Human;SSI3 cDNA ORF Clone, Human

SOCS3 Background Information

Suppressor of cytokine signaling 3, also known as SOCS-3, Cytokine-inducible SH2 protein 3, CIS-3, STAT-induced STAT inhibitor 3, SOCS3 and CIS3, is a protein which is widely expressed with high expression in heart, placenta, skeletal muscle, peripheral blood leukocytes, fetal and adult lung, and fetal liver and kidney. SOCS3 / CIS3 contains one SH2 domain and one SOCS box domain. SOCS family proteins form part of a classical negative feedback system that regulates cytokine signal transduction. SOCS3 / CIS3 is involved in negative regulation of cytokines that signal through the JAK / STAT pathway. SOCS3 / CIS3 inhibits cytokine signal transduction by binding to tyrosine kinase receptors including gp13, LIF, erythropoietin, insulin, IL12, GCSF and leptin receptors. Binding to JAK2 inhibits its kinase activity. SOCS3 / CIS3 suppresses fetal liver erythropoiesis. It regulates onset and maintenance of allergic responses mediated by T-helper type 2 cells. SOCS3 / CIS3 regulates IL-6 signaling. SOCS3 / CIS3 interacts with multiple activated proteins of the tyrosine kinase signaling pathway including IGF1 receptor, insulin receptor and JAK2. SOCS3 / CIS3 could be used as a possible therapeutic agent for treating rheumatoid arthritis.
Full Name
suppressor of cytokine signaling 3
References
  • Hoertner M., et al., 2002, Eur. J. Biochem. 269:2516-26.
  • Yamamoto K., et al., 2003, Biochem. Biophys. Res. Commun. 310 : 1188-93.
  • Kamura T., et al., 2004, Genes Dev. 18:3055-65.
  • Okamura A., et al., 2004, Blood 103:2997-3004.
  • Ekelund E., et al., 2006, Am. J. Hum. Genet. 78:1060-5.
  • SOCS3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SOCS3 cDNA ORF Clone, Mouse, untagged MG57073-UT
    SOCS3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57073-ACGLN
    SOCS3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57073-ACG
    SOCS3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57073-ANG
    SOCS3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57073-ACR
    SOCS3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57073-ANR
    SOCS3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57073-CF
    SOCS3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57073-NF
    SOCS3 cDNA ORF Clone, Mouse, C-His tag MG57073-CH
    SOCS3 cDNA ORF Clone, Mouse, N-His tag MG57073-NH
    SOCS3 cDNA ORF Clone, Mouse, C-HA tag MG57073-CY
    SOCS3 cDNA ORF Clone, Mouse, N-HA tag MG57073-NY
    SOCS3 cDNA ORF Clone, Mouse, C-Myc tag MG57073-CM
    SOCS3 cDNA ORF Clone, Mouse, N-Myc tag MG57073-NM

    SOCS3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SOCS3 cDNA ORF Clone, Human, untagged HG11315-UT
    SOCS3 cDNA ORF Clone, Human, C-GFPSpark® tag HG11315-ACG
    SOCS3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11315-ACGLN
    SOCS3 cDNA ORF Clone, Human, N-GFPSpark® tag HG11315-ANG
    SOCS3 cDNA ORF Clone, Human, C-OFPSpark® tag HG11315-ACR
    SOCS3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11315-CF
    SOCS3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11315-NF
    SOCS3 cDNA ORF Clone, Human, C-His tag HG11315-CH
    SOCS3 cDNA ORF Clone, Human, N-His tag HG11315-NH
    SOCS3 cDNA ORF Clone, Human, N-HA tag HG11315-NY
    SOCS3 cDNA ORF Clone, Human, C-Myc tag HG11315-CM
    SOCS3 cDNA ORF Clone, Human, N-Myc tag HG11315-NM
    SOCS3 qPCR Primer Pairs, Human HP101201
    info info
    添加购物车成功! 添加购物车失败!