Schnelle Bestellung

Mensch SNAI2 / Snail2 / slug Gene ORF cDNA clone expression plasmid

  • Human SNAI2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch SNAI2 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_003068.3
cDNA-Größe:807bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens snail homolog 2 (Drosophila).
Synonyme für Gene:SLUG, WS2D, SLUGH1, MGC10182, SNAI2
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:pCMV3-SNAI2
Restriktionsschnittstelle:KpnI + NotI (6.1kb + 0.81kb)
Tag-Sequenz:
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with SNAI2 qPCR primers for gene expression analysis, HP101101 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Mensch SNAI2 Gene Plasmid Map
Human SNAI2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Mensch SNAI2 / Snail2 / slug Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name
Size / Price
Katalog: HG11196-UT
Listenpreis: 
Preis:      (You Save: )

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“