After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mensch SMOC-1 Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human SMOC1 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001034852.1
cDNA-Größe:1308bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens SPARC related modular calcium binding 1.
Synonyme für Gene:SMOC1
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Hintergrund

SPARC-related modular calcium-binding protein 1, also known as secreted modular calcium-binding protein 1 and SMOC1, is a member of the SPARC family. SMOC1 is widely expressed in many tissues with a strongest signal in ovary. It contains two EF-hand domains, one Kazal-like domain and two thyroglobulin type-1 domains. Extracellular matrix proteins have been implicated in the regulation of osteoblast differentiation of bone marrow derived mesenchymal stem cells (BMSCs) through paracrine or autocrine mechanisms. SMOC1 is a regulator of osteoblast differentiation of BMSCs. SMOC1 is highly expressed and secreted in BMSCs stimulated with osteogenic medium (OSM). SMOC1 and SMOC2 are matricellular proteins thought to influence growth factor signaling, migration, proliferation, and angiogenesis. SMOC1 and SMOC2 may mediate intercellular signaling and cell type-specific differentiation during gonad and reproductive tract development.

Referenzen
  • Vannahme C. et al., 2002 J. Biol. Chem. 277:37977-86.
  • Pazin,D.E. et al., 2009, Dev Dyn. 238 (11): 2877-90.
  • Choi,Y.A. et al., 2010, J Proteome Res. 9 (6):2946-56.
  • Size / Price
    Katalog: HG12026-UT
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“