After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mensch SerpinA7 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human SERPINA7 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_000354.4
cDNA-Größe:1248bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7 with C terminal Flag tag.
Synonyme für Gene:TBG,
Spezies:Human
Vektor:pCMV3-C-FLAG
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Hintergrund

Thyroxine-binding globulin, also known as T4-binding globulin, Serpin A7 and TBG, is a secreted protein which belongs to the serpin family. TBG is synthesized primarily in the liver as a 54 kDa protein.TBG is genomically a serpin, although it has no inhibitory function like many other members of this class of proteins. TBG binds thyroid hormone in circulation. It is one of three proteins (along with transthyretin and albumin) responsible for carrying the thyroid hormones thyroxine (T4) and 3,5,3’-triiodothyronine (T3) in the bloodstream. Of these three proteins, TBG has the highest affinity for T4 and T3, but is present in the lowest concentration. Despite its low concentration, TBG carries the majority of T4 in serum. Due to the very low serum concentration of T4 and T3, TBG is rarely more than 25% saturated with its ligand. Unlike transthyretin and albumin, TBG has a single binding site for T4/T3. TBG tests are sometimes used in finding the reason for elevated or diminished levels of thyroid hormone.

Size / Price
Katalog: HG10993-CF
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
Verfügbarkeit2-3 weeks
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
Contact Us
Bilder
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“