After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mensch SEMA6A Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human SEMA6A Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_020796.3
cDNA-Größe:3093bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A.
Synonyme für Gene:VIA, SEMA, HT018, SEMAQ, SEMA6A1, KIAA1368, SEMA6A
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:pCMV3-SEMA6A
Restriktionsschnittstelle:KpnI + NotI (6.1kb + 3.09kb)
Tag-Sequenz:
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Human SEMA6A Gene Plasmid Map
Human SEMA6A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Referenzen
  • Klostermann A., et al., 2000, J. Biol. Chem. 275:39647-53.
  • Nagase T., et al., 2000, DNA Res. 7:65-73.
  • Schmutz J., et al., 2004, Nature 431:268-74.
  • Neufeld, G. et al., 2005, Front Biosci. 10 : 751-60.
  • Fiore,R. et al., 2005, Mol Cell Biol. 25 (6):2310-9.
  • Size / Price
    Katalog: HG11189-UT
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    VerfügbarkeitIn Stock
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
    • Human SEMA6A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“