Schnelle Bestellung

Mensch PSGL-1/CD162 Gene ORF cDNA clone expression plasmid, C-HA tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Mensch SELPLG Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:NM_003006.3
    cDNA-Größe:1209bp
    cDNA-Beschreibung:Full length Clone DNA of Homo sapiens selectin P ligand with C terminal HA tag.
    Synonyme für Gene:CLA, CD162, PSGL1, PSGL-1, SELPLG
    Spezies:Human
    Vektor:pCMV3-C-HA
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SELPLG qPCR primers for gene expression analysis, HP100511 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Hintergrund

    P-selectin glycoprotein ligand-1 (PSGL-1), also known as SELPLG or CD162, is the high affinitycounter-receptor for P-selectin on expressed on activated endothelial cells and platelets. PSGL-1 is a mucin-type glycoprotein, expressed on leukocytes and platelets as a homodimer of two disulfide-linked subunits of ~120 kD. As cell adhesion molecules, multiple studies have shown that PSGL-1/ P-selectin interaction is required for the normal recruitment of leukocytes during inflammatory reactions, and also participates in hemostatic responses. PSGL-1 protein requires two distinct posttranslational modifications for the Ca2+-dependent recognition by the lectin domain of P-selectin, that is tyrosine sulfation and specific O-linked glycosylation (sialic acid and fucose). PSGL-1 can also bind to other two members of the selectin family, E-selectin (endothelial) and L-selectin (leukocyte), but binds best to P-selectin.

    Referenzen

    1. Sako, D. et al., 1993, Cell. 75: 1179-1186.

    2. Wilkins, P. P. et al., 1995, J. Biol. Chem. 270: 22677-22680.

    3. Frenette, P. S. et al., 2000, J. Exp. Med. 191: 1413-1422.

    4. Vandendries, E.R .et al., 2004, Thromb. Haemost. 92: 459-466..

    5. Pouyani, T. et al., 1995, Cell. 83: 333-343.

    Size / Price
    Katalog: HG10490-CY
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“