After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mensch S100A7 Gene ORF cDNA clone expression plasmid, C-HA tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human S100A7 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_002963.3
cDNA-Größe:306bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens S100 calcium binding protein A7 with C terminal HA tag.
Synonyme für Gene:PSOR1, S100A7c, S100A7
Spezies:Human
Vektor:pCMV3-C-HA
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Hintergrund

Protein S100-A7, also known as S100 calcium-binding protein A7, Psoriasin, S100A7, and PSOR1, is a secreted protein which belongs to the S-100 family. S100A7 was first isolated from skin involved by psoriasis, which can be induced in cultured squamous epithelial cells. S100A7 is expressed by both normal cultured and malignant keratinocytes and malignant breast epithelial cells within ductal carcinoma in situ, suggesting an association with abnormal pathways of differentiation. S100A7 plays a role in the pathogenesis of inflammatory skin disease, as a chemotactic factor for hematopoietic cells. It also plays a role in early stages of breast tumor progression in association with the development of the invasive phenotype.

Referenzen
  • Miyasaki, KT. et al., 1993, J. Dent. Res. 72: 517-23.
  • Watson, PH. et al., 1998, Int J Biochem Cell Biol  30 (5):567-71.
  • Emberley, ED. et al., 2004, Breast Cancer Res  6 (4): 153-9.
  • Ohuchida, K. et al., 2006, Clin Cancer Res  12 (18):5417-22.
  • Kouno, T. et al., 2008, J Pept Sci. 14 (10):1129-38.
  • León, R. et al., 2009, Biochemistry. 48 (44): 10591-600.
  • Size / Price
    Katalog: HG11141-CY
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“