After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mensch Raf-1/RAF1 Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human RAF1 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_002880.3
cDNA-Größe:1947bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens v-raf-1 murine leukemia viral oncogene homolog 1.
Synonyme für Gene:NS5, CRAF, Raf-1, c-Raf
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:pCMV3-RAF1
Restriktionsschnittstelle:KpnI + XbaI (6.1kb + 1.95kb)
Tag-Sequenz:
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Human RAF1 Gene Plasmid Map
Human Raf-1 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Katalog: HG10657-UT
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
VerfügbarkeitIn Stock
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
Contact Us
Bilder
  • Human Raf-1 natural ORF mammalian expression plasmid
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“