C20orf43 cDNA ORF Clone, Human, C-HA tag

Cat: HG16238-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All C20orf43 Reagents

CRO Services

Product recommended


All C20orf43 Reagents

C20orf43 cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
921 bp
Description
Full length Clone DNA of Human replication termination factor 2 domain containing 1 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

C20orf43 cDNA ORF Clone, Human, C-HA tag Alternative Names

C20orf43 cDNA ORF Clone, Human;CDAO5 cDNA ORF Clone, Human;HSPC164 cDNA ORF Clone, Human;SHUJUN-3 cDNA ORF Clone, Human

C20orf43 Background Information

C20orf43 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
C20orf43 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90509-U
C20orf43 cDNA ORF Clone, Cynomolgus, untagged CG90509-UT
C20orf43 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90509-ACG
C20orf43 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90509-ACGLN
C20orf43 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90509-ANG
C20orf43 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90509-ACR
C20orf43 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90509-ANR
C20orf43 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90509-CF
C20orf43 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90509-NF
C20orf43 cDNA ORF Clone, Cynomolgus, C-His tag CG90509-CH
C20orf43 cDNA ORF Clone, Cynomolgus, N-His tag CG90509-NH
C20orf43 cDNA ORF Clone, Cynomolgus, C-HA tag CG90509-CY
C20orf43 cDNA ORF Clone, Cynomolgus, N-HA tag CG90509-NY
C20orf43 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90509-CM
C20orf43 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90509-NM

C20orf43 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
C20orf43 cDNA ORF Clone in Cloning Vector, Rhesus CG90428-G
C20orf43 cDNA ORF Clone, Rhesus, untagged CG90428-UT
C20orf43 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90428-ACG
C20orf43 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90428-ANG
C20orf43 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90428-ACR
C20orf43 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90428-ANR
C20orf43 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90428-CF
C20orf43 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90428-NF
C20orf43 cDNA ORF Clone, Rhesus, C-His tag CG90428-CH
C20orf43 cDNA ORF Clone, Rhesus, N-His tag CG90428-NH
C20orf43 cDNA ORF Clone, Rhesus, C-HA tag CG90428-CY
C20orf43 cDNA ORF Clone, Rhesus, N-HA tag CG90428-NY
C20orf43 cDNA ORF Clone, Rhesus, C-Myc tag CG90428-CM
C20orf43 cDNA ORF Clone, Rhesus, N-Myc tag CG90428-NM

C20orf43 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
C20orf43 cDNA ORF Clone in Cloning Vector, Rabbit TG65051-G
C20orf43 cDNA ORF Clone, Rabbit, untagged TG65051-UT
C20orf43 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65051-ACG
C20orf43 Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65051-ACGLN
C20orf43 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65051-ANG
C20orf43 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65051-ACR
C20orf43 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65051-ANR
C20orf43 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65051-CF
C20orf43 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65051-NF
C20orf43 cDNA ORF Clone, Rabbit, C-His tag TG65051-CH
C20orf43 cDNA ORF Clone, Rabbit, N-His tag TG65051-NH
C20orf43 cDNA ORF Clone, Rabbit, C-HA tag TG65051-CY
C20orf43 cDNA ORF Clone, Rabbit, N-HA tag TG65051-NY
C20orf43 cDNA ORF Clone, Rabbit, C-Myc tag TG65051-CM
C20orf43 cDNA ORF Clone, Rabbit, N-Myc tag TG65051-NM

C20orf43 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
C20orf43 cDNA ORF Clone in Cloning Vector, Mouse MG5A6463-U
C20orf43 cDNA ORF Clone, Mouse, untagged MG5A6463-UT
C20orf43 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6463-ACG
C20orf43 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A6463-ANG
C20orf43 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A6463-ACR
C20orf43 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A6463-ANR
C20orf43 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A6463-CF
C20orf43 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A6463-NF
C20orf43 cDNA ORF Clone, Mouse, C-His tag MG5A6463-CH
C20orf43 cDNA ORF Clone, Mouse, N-His tag MG5A6463-NH
C20orf43 cDNA ORF Clone, Mouse, C-HA tag MG5A6463-CY
C20orf43 cDNA ORF Clone, Mouse, N-HA tag MG5A6463-NY
C20orf43 cDNA ORF Clone, Mouse, C-Myc tag MG5A6463-CM
C20orf43 cDNA ORF Clone, Mouse, N-Myc tag MG5A6463-NM

C20orf43 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
C20orf43 cDNA ORF Clone in Cloning Vector, Human HG16238-G
C20orf43 cDNA ORF Clone, Human, untagged HG16238-UT
C20orf43 cDNA ORF Clone, Human, C-GFPSpark® tag HG16238-ACG
C20orf43 cDNA ORF Clone, Human, N-GFPSpark® tag HG16238-ANG
C20orf43 cDNA ORF Clone, Human, C-OFPSpark® tag HG16238-ACR
C20orf43 cDNA ORF Clone, Human, N-OFPSpark® tag HG16238-ANR
C20orf43 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16238-CF
C20orf43 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16238-NF
C20orf43 cDNA ORF Clone, Human, C-His tag HG16238-CH
C20orf43 cDNA ORF Clone, Human, N-His tag HG16238-NH
C20orf43 cDNA ORF Clone, Human, N-HA tag HG16238-NY
C20orf43 cDNA ORF Clone, Human, C-Myc tag HG16238-CM
C20orf43 cDNA ORF Clone, Human, N-Myc tag HG16238-NM
C20orf43 qPCR Primer Pairs, Human HP105002
info info
添加购物车成功! 添加购物车失败!