RSK3 cDNA ORF Clone, Human, C-HA tag

Cat: HG10833-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RSK3 Reagents
CRO Services
Product recommended

All RSK3 Reagents
RSK3 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2202 bp
Description
Full length Clone DNA of Human ribosomal protein S6 kinase, 90kDa, polypeptide 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RSK3 cDNA ORF Clone, Human, C-HA tag Alternative Names
HU-2 cDNA ORF Clone, Human;MAPKAPK1C cDNA ORF Clone, Human;p90-RSK3 cDNA ORF Clone, Human;pp90RSK3 cDNA ORF Clone, Human;RSK cDNA ORF Clone, Human;RSK3 cDNA ORF Clone, Human;S6K-alpha cDNA ORF Clone, Human;S6K-alpha2 cDNA ORF Clone, Human
RSK3 Background Information

Ribosomal protein S6 kinase alpha-2, also known as 90 kDa ribosomal protein S6 kinase 2, MAP kinase-activated protein kinase 1c, MAPK-activated protein kinase 1c, Ribosomal S6 kinase 3, RSK-3, RPS6KA2 and MAPKAPK1C, is a nucleus protein which belongs to the protein kinase superfamily, AGC Ser/Thr protein kinase family and S6 kinase subfamily. RPS6KA2 / RSK-3 is expressed in many tissues. Highest expression is in lung and skeletal muscle. The expression of RPS6KA2 reduced proliferation, caused G1 arrest, increased apoptosis, reduced levels of phosphorylated extracellular signal-regulated kinase and altered other cell cycle proteins. RPS6KA2 / RSK-3 contains one AGC-kinase C-terminal domain and two protein kinase domains. It forms a complex with either ERK1 or ERK2 in quiescent cells. It transiently dissociates following mitogenic stimulation. RPS6KA2 / RSK-3 is a serine/threonine kinase that may play a role in mediating the growth-factor and stress induced activation of the transcription factor CREB. RPS6KA1, RPS6KA2, RPS6KB1, RPS6KB2, and PDK1 are involved in several pathways central to the carcinogenic process, including regulation of cell growth, insulin, and inflammation. 

Full Name
ribosomal protein S6 kinase, 90kDa, polypeptide 2
References
  • Zhao Y., et al.,(1995), RSK3 encodes a novel pp90rsk isoform with a unique N-terminal sequence: growth factor-stimulated kinase function and nuclear translocation. Mol. Cell. Biol. 15:4353-4363.
  • Mungall A.J., et al., (2003), The DNA sequence and analysis of human chromosome 6.Nature 425:805-811.
  • Ota T., et al.,(2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.
  • info info
    添加购物车成功! 添加购物车失败!