RPL5 cDNA ORF Clone, Human, C-Myc tag

Cat: HG16280-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPL5 Reagents
CRO Services
Product recommended

All RPL5 Reagents
RPL5 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
894 bp
Description
Full length Clone DNA of Human ribosomal protein L5 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPL5 cDNA ORF Clone, Human, C-Myc tag Alternative Names
DBA6 cDNA ORF Clone, Human;L5 cDNA ORF Clone, Human;MSTP030 cDNA ORF Clone, Human;PPP1R135 cDNA ORF Clone, Human
RPL5 Background Information
Full Name
ribosomal protein L5

RPL5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPL5 cDNA ORF Clone in Cloning Vector, Mouse MG53178-G
RPL5 cDNA ORF Clone, Mouse, untagged MG53178-UT
RPL5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53178-ACG
RPL5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53178-ACGLN
RPL5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53178-ANG
RPL5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53178-ACR
RPL5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53178-ANR
RPL5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53178-CF
RPL5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53178-NF
RPL5 cDNA ORF Clone, Mouse, C-His tag MG53178-CH
RPL5 cDNA ORF Clone, Mouse, N-His tag MG53178-NH
RPL5 cDNA ORF Clone, Mouse, C-HA tag MG53178-CY
RPL5 cDNA ORF Clone, Mouse, N-HA tag MG53178-NY
RPL5 cDNA ORF Clone, Mouse, C-Myc tag MG53178-CM
RPL5 cDNA ORF Clone, Mouse, N-Myc tag MG53178-NM

RPL5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPL5 cDNA ORF Clone in Cloning Vector, Human HG16280-G
RPL5 cDNA ORF Clone, Human, untagged HG16280-UT
RPL5 cDNA ORF Clone, Human, C-GFPSpark® tag HG16280-ACG
RPL5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16280-ACGLN
RPL5 cDNA ORF Clone, Human, N-GFPSpark® tag HG16280-ANG
RPL5 cDNA ORF Clone, Human, C-OFPSpark® tag HG16280-ACR
RPL5 cDNA ORF Clone, Human, N-OFPSpark® tag HG16280-ANR
RPL5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16280-CF
RPL5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16280-NF
RPL5 cDNA ORF Clone, Human, C-His tag HG16280-CH
RPL5 cDNA ORF Clone, Human, N-His tag HG16280-NH
RPL5 cDNA ORF Clone, Human, C-HA tag HG16280-CY
RPL5 cDNA ORF Clone, Human, N-HA tag HG16280-NY
RPL5 cDNA ORF Clone, Human, N-Myc tag HG16280-NM
RPL5 qPCR Primer Pairs, Human HP105034
info info
添加购物车成功! 添加购物车失败!