Schnelle Bestellung

Mensch RPGR transcript variant A Gene ORF cDNA clone expression plasmid, N-HA tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Mensch RPGR Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:NM_000328.2
    cDNA-Größe:2448bp
    cDNA-Beschreibung:Full length Clone DNA of Homo sapiens retinitis pigmentosa GTPase regulator, transcript variant A with N terminal HA tag.
    Synonyme für Gene:CRD, RP3, COD1, PCDX, RP15, XLRP3, orf15, CORDX1
    Spezies:Human
    Vektor:pCMV3-N-HA
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RPGR qPCR primers for gene expression analysis, HP100542 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Mensch RPGR transcript variant A Gene ORF cDNA clone expression plasmid, N-HA tag on other vectors
    Product nameProduct name
    Size / Price
    Katalog: HG10525-NY
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“