Schnelle Bestellung

Human RMDN3 / FAM82A2 ORF mammalian expression plasmid, C-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human RMDN3 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_018145.1
cDNA-Größe:1413bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens family with sequence similarity 82, member A2 with C terminal His tag.
Synonyme für Gene:RMD3, FAM82C, hRMD-3, ptpip51, FLJ10579, FAM82A2
Spezies:Human
Vektor:pCMV3-C-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Katalog: HG13386-CH
Listenpreis:   (Save )
Preis:      [How to order]
Verfügbarkeit
 Anweisungen für die Lieferung
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“