Schnelle Bestellung

Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Mensch RGS5 Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:BC030059
    cDNA-Größe:546bp
    cDNA-Beschreibung:Full length Clone DNA of Homo sapiens regulator of G-protein signaling 5 DNA.
    Synonyme für Gene:MST092, MST106, MST129, MSTP032, MSTP092, MSTP106, MSTP129
    Spezies:Human
    Vektor:pCMV3-untagged
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RGS5 qPCR primers for gene expression analysis, HP103860 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid on other vectors
    Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG15234-ACG$225
    Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG15234-ACR$225
    Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG15234-ANG$225
    Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG15234-ANR$225
    Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-Flag tagHG15234-CF$195
    Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-His tagHG15234-CH$195
    Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-Myc tagHG15234-CM$195
    Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-HA tagHG15234-CY$195
    Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone in cloning vectorHG15234-G$75
    Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-Flag tagHG15234-NF$195
    Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-His tagHG15234-NH$195
    Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-Myc tagHG15234-NM$195
    Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-HA tagHG15234-NY$195
    Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmidHG15234-UT$195
     Erfahren Sie mehr über Expressionsvektoren
    Product nameProduct name
    Size / Price
    Katalog: HG15234-UT
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“