After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human RGS5 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:BC030059
cDNA-Größe:546bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens regulator of G-protein signaling 5 DNA.
Synonyme für Gene:MST092, MST106, MST129, MSTP032, MSTP092, MSTP106, MSTP129
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid on other vectors
Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG15234-ACG$225
Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG15234-ACR$225
Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG15234-ANG$225
Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG15234-ANR$225
Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-Flag tagHG15234-CF$195
Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-His tagHG15234-CH$195
Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-Myc tagHG15234-CM$195
Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-HA tagHG15234-CY$195
Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone in cloning vectorHG15234-G$75
Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-Flag tagHG15234-NF$195
Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-His tagHG15234-NH$195
Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-Myc tagHG15234-NM$195
Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-HA tagHG15234-NY$195
Mensch RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmidHG15234-UT$195
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Size / Price
Katalog: HG15234-UT
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
Verfügbarkeit2-3 weeks
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
Contact Us
Bilder
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“