After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Human RAB5A ORF mammalian expression plasmid, C-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human RAB5A Produktinformation zum cDNA-Klon
Gene_bank_ref_id:BC001267
cDNA-Größe:648bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens RAB5A, member RAS oncogene family with C terminal His tag.
Synonyme für Gene:RAB5, RAB5A
Spezies:Human
Vektor:pCMV3-C-His
Plasmid:pCMV3-Rab5-His
Restriktionsschnittstelle:KpnI + XbaI (6kb + 0.69kb)
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Human RAB5A Gene Plasmid Map
Human RAB5A ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Katalog: HG14013-CH
Listenpreis:   (Save )
Preis:      [How to order]
Verfügbarkeit
 Anweisungen für die Lieferung
Bilder
  • Human RAB5A ORF mammalian expression plasmid, C-His tag
    Kürzlich angesehene Artikel
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“