Schnelle Bestellung

Mensch RAB39B Gene ORF cDNA clone expression plasmid, C-His tag

  • other Green fluorescent protein / GFP Gene Plasmid Map 5610
DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch RAB39B Produktinformation zum cDNA-Klon
Gene_bank_ref_id:BC009714
cDNA-Größe:687 bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens RAB39B, member RAS oncogene family with C terminal His tag.
Synonyme für Gene:MRX72, RAB39B
Spezies:Human
Vektor:pCMV3-C-His
Plasmid:pCMV3-RAB39B-His
Restriktionsschnittstelle:KpnI + XbaI(6kb+0.69kb)
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with RAB39B qPCR primers for gene expression analysis, HP102667 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Katalog: HG14011-CH
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
VerfügbarkeitIn Stock
Zum Einkaufswagen hinzufügenAnfrage zu Großauftrag

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“