RAB14 cDNA ORF Clone, Human, C-HA tag

Cat: HG15033-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All RAB14 Reagents

CRO Services

Product recommended


All RAB14 Reagents

RAB14 cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
690 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human RAB14, member RAS oncogene family with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.69kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RAB14 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB14 cDNA ORF Clone, Human, C-HA tag Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5612

RAB14 cDNA ORF Clone, Human, C-HA tag Alternative Names

FBP cDNA ORF Clone, Human;RAB-14 cDNA ORF Clone, Human

RAB14 Background Information

Full Name
RAB14, member RAS oncogene family

RAB14 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RAB14 cDNA ORF Clone in Cloning Vector, Rat RG83973-U
RAB14 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83973-ACGLN

RAB14 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RAB14 cDNA ORF Clone in Cloning Vector, Mouse MG5A2036-U
RAB14 cDNA ORF Clone, Mouse, untagged MG5A2036-UT
RAB14 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2036-ACGLN
RAB14 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2036-ACG
RAB14 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A2036-ANG
RAB14 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2036-ACR
RAB14 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A2036-ANR
RAB14 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2036-CF
RAB14 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2036-NF
RAB14 cDNA ORF Clone, Mouse, C-His tag MG5A2036-CH
RAB14 cDNA ORF Clone, Mouse, N-His tag MG5A2036-NH
RAB14 cDNA ORF Clone, Mouse, C-HA tag MG5A2036-CY
RAB14 cDNA ORF Clone, Mouse, N-HA tag MG5A2036-NY
RAB14 cDNA ORF Clone, Mouse, C-Myc tag MG5A2036-CM
RAB14 cDNA ORF Clone, Mouse, N-Myc tag MG5A2036-NM

RAB14 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RAB14 cDNA ORF Clone in Cloning Vector, Human HG15033-G
RAB14 cDNA ORF Clone, Human, untagged HG15033-UT
RAB14 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15033-ACGLN
RAB14 cDNA ORF Clone, Human, C-GFPSpark® tag HG15033-ACG
RAB14 cDNA ORF Clone, Human, N-GFPSpark® tag HG15033-ANG
RAB14 cDNA ORF Clone, Human, C-OFPSpark® tag HG15033-ACR
RAB14 cDNA ORF Clone, Human, N-OFPSpark® tag HG15033-ANR
RAB14 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15033-CF
RAB14 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15033-NF
RAB14 cDNA ORF Clone, Human, C-His tag HG15033-CH
RAB14 cDNA ORF Clone, Human, N-His tag HG15033-NH
RAB14 cDNA ORF Clone, Human, N-HA tag HG15033-NY
RAB14 cDNA ORF Clone, Human, C-Myc tag HG15033-CM
RAB14 cDNA ORF Clone, Human, N-Myc tag HG15033-NM
RAB14 qPCR Primer Pairs, Human HP103661
info info
添加购物车成功! 添加购物车失败!