Prostasin cDNA ORF Clone, Human, untagged

Cat: HG10287-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Prostasin Reagents
CRO Services
Product recommended

All Prostasin Reagents
Prostasin cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1032 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human protease, serine, 8.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
HindIII + XbaI (6.1kb + 1.03kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Prostasin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Prostasin cDNA ORF Clone, Human, untagged Validated Images
Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5624
Prostasin cDNA ORF Clone, Human, untagged Alternative Names
CAP1 cDNA ORF Clone, Human;PROSTASIN cDNA ORF Clone, Human
Prostasin Background Information

Prostasin (Prss8), also known as channel activating protease 1 (CAP1), is a trypsinlike serine peptidase, and plays important roles in epithelial physiology. It is originally purified as an active, soluble enzyme from human seminal fluid and is highly expressed in prostate, lung, kidney, salivary gland and pancreas. Prostasin is expressed as a glycosyl-phosphatidylinositol (GPI)-anchored membrane protein in prostate epithelial cells, and also exists as a secreted proteolytic enzyme possibly via tryptic cleavage of its COOH-terminal hydrophobic domain. Prostasin is found to activate the epithelial sodium channel (ENaC) which is tightly regulated and is critical for maintaining salt and fluid balance in the lung and kidney in both normal and pathological conditions. Accordingly, prostasin has been proposed as a target for therapeutic inhibition in cystic fibrosis. In addition, prostasin inhibits prostate and breast cancer cell invasion in vitro, suggesting a functional role as a suppressor of tumor invasion, as well as a regulator of gene expression during inflammation.

Full Name
protease, serine, 8
References
  • Yu J.X., et al.,(1995), Molecular cloning, tissue-specific expression, and cellular localization of human prostasin mRNA. J. Biol. Chem. 270:13483-13489.
  • Ota T., et al., (2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.
  • Martin J., et al.,(2004), The sequence and analysis of duplication-rich human chromosome 16.Nature 432:988-994.
  • Prostasin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Prostasin cDNA ORF Clone in Cloning Vector, Rat RG81412-G

    Prostasin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Prostasin cDNA ORF Clone in Cloning Vector, Mouse MG50120-M
    Prostasin cDNA ORF Clone, Mouse, untagged MG50120-UT
    Prostasin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50120-ACGLN
    Prostasin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50120-ACG
    Prostasin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50120-ACR
    Prostasin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50120-CF
    Prostasin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50120-NF
    Prostasin cDNA ORF Clone, Mouse, C-His tag MG50120-CH
    Prostasin cDNA ORF Clone, Mouse, N-His tag MG50120-NH
    Prostasin cDNA ORF Clone, Mouse, C-HA tag MG50120-CY
    Prostasin cDNA ORF Clone, Mouse, N-HA tag MG50120-NY
    Prostasin cDNA ORF Clone, Mouse, C-Myc tag MG50120-CM
    Prostasin cDNA ORF Clone, Mouse, N-Myc tag MG50120-NM
    Prostasin qPCR Primer Pairs, Mouse MP200150

    Prostasin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Prostasin cDNA ORF Clone in Cloning Vector, Human HG10287-M
    Prostasin cDNA ORF Clone, Human, C-GFPSpark® tag HG10287-ACG
    Prostasin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10287-ACGLN
    Prostasin cDNA ORF Clone, Human, C-OFPSpark® tag HG10287-ACR
    Prostasin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10287-CF
    Prostasin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10287-NF
    Prostasin cDNA ORF Clone, Human, C-His tag HG10287-CH
    Prostasin cDNA ORF Clone, Human, N-His tag HG10287-NH
    Prostasin cDNA ORF Clone, Human, C-HA tag HG10287-CY
    Prostasin cDNA ORF Clone, Human, N-HA tag HG10287-NY
    Prostasin cDNA ORF Clone, Human, C-Myc tag HG10287-CM
    Prostasin cDNA ORF Clone, Human, N-Myc tag HG10287-NM
    Prostasin qPCR Primer Pairs, Human HP100332
    info info
    添加购物车成功! 添加购物车失败!