After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mensch PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human PTPN2 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_080422.1
cDNA-Größe:1164bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens protein tyrosine phosphatase, non-receptor type 2, transcript variant 2 with N terminal Flag tag.
Synonyme für Gene:PTPT, TCPTP, TC-PTP, TCELLPTP
Spezies:Human
Vektor:pCMV3-N-FLAG
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Mensch PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag tag on other vectors
Mensch PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10571-ACG$225
Mensch PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10571-ACR$225
Mensch PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10571-ANG$225
Mensch PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10571-ANR$225
Mensch PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10571-CF$195
Mensch PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His tagHG10571-CH$195
Mensch PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10571-CM$195
Mensch PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tagHG10571-CY$195
Mensch PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone in cloning vectorHG10571-M$75
Mensch PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10571-M-F$195
Mensch PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10571-NF$195
Mensch PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His tagHG10571-NH$195
Mensch PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10571-NM$195
Mensch PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA tagHG10571-NY$195
Mensch PTPN2/TC-PTP transcript variant 2 Gene ORF cDNA clone expression plasmidHG10571-UT$195
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Hintergrund

Tyrosine-protein phosphatase non-receptor type 2, also known as T-cell protein-tyrosine phosphatase, PTPN2 and PTPT, is a cytoplasm protein which belongs to the protein-tyrosine phosphatase family and Non-receptor class 1 subfamily. Members of the protein tyrosine phosphatase ( PTP ) family share a highly conserved catalytic motif, which is essential for the catalytic activity. TC-PTP / PTPN2 is a cytosolic tyrosine phosphatase that functions as a negative regulator of a variety of tyrosine kinases and other signaling proteins. The expression of TC-PTP / PTPN2 plays a role of tumor suppressor and may modulate response to treatment. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Epidermal growth factor receptor and the adaptor protein Shc were reported to be substrates of this PTP, which suggested the roles in growth factor mediated cell signaling. TC-PTP / PTPN2 is an enzyme that is essential for the proper functioning of the immune system and that participates in the control of cell proliferation, and inflammation. TC-PTP / PTPN2 was identified as a negative regulator of NUP214-ABL1 kinase activity.

Size / Price
Katalog: HG10571-NF
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
Verfügbarkeit2-3 weeks
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
Contact Us
Bilder
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“