PTGES cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

PTGES cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
459 bp
Description
Full length Clone DNA of Human prostaglandin E synthase with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PTGES cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

MGST-IV cDNA ORF Clone, Human; MGST1-L1 cDNA ORF Clone, Human; MGST1L1 cDNA ORF Clone, Human; MPGES cDNA ORF Clone, Human; mPGES-1 cDNA ORF Clone, Human; PGES cDNA ORF Clone, Human; PIG12 cDNA ORF Clone, Human; PP102 cDNA ORF Clone, Human; PP1294 cDNA ORF Clone, Human; TP53I12 cDNA ORF Clone, Human

PTGES Background Information

Full Name
prostaglandin E synthase
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait