PRPF3 cDNA ORF Clone, Human, N-Myc tag

1/1
Price:
Size:
Number:

PRPF3 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2097 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+2.10kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PRPF3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRPF3 cDNA ORF Clone, Human, N-Myc tag: Validated Images

PRPF3 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

HPRP3 cDNA ORF Clone, Human; HPRP3P cDNA ORF Clone, Human; PRP3 cDNA ORF Clone, Human; Prp3p cDNA ORF Clone, Human; RP18 cDNA ORF Clone, Human; SNRNP90 cDNA ORF Clone, Human

PRPF3 Background Information

Full Name
pre-mRNA processing factor 3
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait