Schnelle Bestellung

Mensch PROS1/Protein S Gene ORF cDNA clone expression plasmid, C-Myc tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Mensch PROS1 Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:BC015801
    cDNA-Größe:2031bp
    cDNA-Beschreibung:Full length Clone DNA of Homo sapiens protein S (alpha) with C terminal Myc tag.
    Synonyme für Gene:PSA, PROS, PS21, PS22, PS23, PS24, PS25, PROS1
    Spezies:Human
    Vektor:pCMV3-C-Myc
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PROS1 qPCR primers for gene expression analysis, HP101835 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Hintergrund

    PROS1, also known as protein S, is a vitamin K-dependent plasma protein that functions as a cofactor for the anticoagulant protease, activated protein C (APC) to inhibit blood coagulation. PROS1 has two isoforms: a free, functionally active form and an inactive form complexed with C4b-binding protein. Besides its anticoagulant function, PROS1 also acts as an agonist for the tyrosine kinase receptors Tyro3, Axl, and Mer. The endothelium expresses Tyro3, Axl, and Mer and produces protein S. The interaction of protein S with endothelial cells and particularly its effects on angiogenesis have not yet been analyzed.

    Referenzen
  • Beauchamp NJ. et al., 2004, Br J Haematol. 125 (5): 647-54.
  • García de Frutos P. et al., 2007, Thromb Haemost. 98 (3): 543-56.
  • Rezende SM. et al., 2004, Blood. 103 (4): 1192-201.
  • Size / Price
    Katalog: HG12179-CM
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“