After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mensch Peroxiredoxin 1/PRDX1 Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human PRDX1 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:BC007063.1
cDNA-Größe:600bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens peroxiredoxin 1.
Synonyme für Gene:PAG, PAGA, PAGB, PRX1, PRXI, MSP23, NKEFA, TDPX2, PRDX1
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:pCMV3-PRDX1
Restriktionsschnittstelle:KpnI + XbaI (6.1kb + 0.6kb)
Tag-Sequenz:
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Human PRDX1 Gene Plasmid Map
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Mensch Peroxiredoxin 1/PRDX1 Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name
Hintergrund

Peroxiredoxin-1, also known as Thioredoxin peroxidase 2, Natural killer cell-enhancing factor A, PRDX1, and PAGA, is a member of the ahpC/TSA family. Peroxiredoxin-1 is constitutively expressed in most human cells. It is induced to higher levels upon serum stimulation in untransformed and transformed cells. Peroxiredoxins (PRDXs) are a family of antioxidant enzymes that are also known as scavengers of peroxide in mammalian cells. The overexpression of Peroxiredoxin-1, which is one of the peroxiredoxins that is a ubiquitously expressed protein, was related to a poor prognosis in several types of human cancers. Peroxiredoxin-1 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system but not from glutaredoxin and may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-1 Might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2. The reduced Peroxiredoxin-1 expression is an important factor in esophageal squamous cancer progression and could serve as a useful prognostic marker.

Referenzen
  • Neumann, CA. et al., 2003, Nature 424 (6948): 561-5
  • Gisin, J. et al., 2005, J Clin Pathol. 58 (11): 1229-31.
  • Hoshino, I. et al., 2007, Oncol Rep. 18 (4): 867-71.
  • Cao, J. et al., 2009, EMBO J. 28 (10): 1505-17.
  • Size / Price
    Katalog: HG11194-UT
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    VerfügbarkeitIn Stock
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
    • Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“