After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mensch PPARG Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human PPARG Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_015869.4
cDNA-Größe:1518bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens peroxisome proliferator-activated receptor gamma.
Synonyme für Gene:PPARG1, PPARG2, NR1C3, PPARgamma
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:pCMV3-PPARG
Restriktionsschnittstelle:KpnI + XbaI (6.1kb + 1.52kb)
Tag-Sequenz:
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Human PPARG Gene Plasmid Map
Human PPARG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Referenzen
  • Hamblin M, et al. (2009) PPARs and the Cardiovascular System. Antioxid Redox Signal. 11 (6): 1415-52.
  • Khateeb J, et al. (2010) Paraoxonase 1 (PON1) expression in hepatocytes is upregulated by pomegranate polyphenols: a role for PPAR-gamma pathway. Atherosclerosis. 208 (1): 119-25.
  • Fajas L, et al. (1997) The organization, promoter analysis, and expression of the human PPARgamma gene. J Biol Chem. 272 (30): 18779-89.
  • Size / Price
    Katalog: HG12019-UT
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    VerfügbarkeitIn Stock
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
    • Human PPARG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“