Schnelle Bestellung

Mensch PMVK / phosphomevalonate kinase Gene ORF cDNA clone expression plasmid, N-Flag tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Mensch PMVK Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:BC006089
    cDNA-Größe:579bp
    cDNA-Beschreibung:Full length Clone DNA of Homo sapiens phosphomevalonate kinase with N terminal Flag tag.
    Synonyme für Gene:PMK, PMKA, PMKASE, HUMPMKI
    Spezies:Human
    Vektor:pCMV3-N-FLAG
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PMVK qPCR primers for gene expression analysis, HP103218 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Mensch PMVK / phosphomevalonate kinase Gene ORF cDNA clone expression plasmid, N-Flag tag on other vectors
    Product nameProduct name
    Hintergrund

    PMVK is a peroxisomal enzyme that catalyzes the conversion of mevalonate 5-phosphate into mevalonate 5-diphosphate, the fifth reaction of the cholesterol biosynthetic pathway. Studies in rat show that the message level and the enzyme activity of PMVK is regulated by sterol, and that this regulation is coordinated with 3-hydroxy-3-methylglutaryl coenzyme A reductase, the rate-limiting enzyme of cholesterol biosynthesis.

    Size / Price
    Katalog: HG14583-NF
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“