After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mensch phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, N-HA tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human PMM2 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:BC008310
cDNA-Größe:741bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens phosphomannomutase 2 with N terminal HA tag.
Synonyme für Gene:PMI, CDG1, CDGS, PMI1, CDG1a, PMM 2
Spezies:Human
Vektor:pCMV3-N-HA
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Mensch phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, N-HA tag on other vectors
Mensch phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG14648-ACG$225
Mensch phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG14648-ACR$225
Mensch phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG14648-ANG$225
Mensch phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG14648-ANR$225
Mensch phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG14648-CF$195
Mensch phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, C-His tagHG14648-CH$195
Mensch phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG14648-CM$195
Mensch phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, C-HA tagHG14648-CY$195
Mensch phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone in cloning vectorHG14648-G$75
Mensch phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG14648-NF$195
Mensch phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, N-His tagHG14648-NH$195
Mensch phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG14648-NM$195
Mensch phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmid, N-HA tagHG14648-NY$195
Mensch phosphomannomutase 2 / PMM2 / CDG1 Gene ORF cDNA clone expression plasmidHG14648-UT$195
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Hintergrund

Phosphomannomutase 2, also known as PMM2 and CDG1, belongs to the eukaryotic PMM family. Phosphomannomutase 2 catalyzes the isomerization of mannose 6-phosphate to mannose 1-phosphate. Mannose 1-phosphate is a precursor to GDP-mannose necessary for the synthesis of dolichol-P-oligosaccharides. GDP-mannose can transfer its small sugar molecule called mannose to the growing oligosaccharide chain. Once the correct number of small sugar molecules are linked together to form the oligosaccharide, it can be attached to a protein. Phosphomannomutase 2 is also required for a number of critical mannosyl transfer reactions. Mutations in PMM2 gene have been shown to cause defects in the protein glycosylation pathway manifest as carbohydrate-deficient glycoprotein syndrome type I.

Referenzen
  • Jaeken J. et al., 2002, Annual review of genomics and human genetics. 2: 129-51.
  • Matthijs G. et al., 2000, Mol Genet Metab. 68 (2): 220-6.
  • Matthijs G. et al., 1997, Nat Genet. 16 (1): 88-92.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“