Schnelle Bestellung

Mensch PKC-nu/PRKD3 Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human PRKD3 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_005813.3
cDNA-Größe:2673bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens protein kinase D3.
Synonyme für Gene:EPK2, PKD3, PRKCN, PKC-NU, nPKC-NU, PRKD3
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Hintergrund

Serine/threonine-protein kinase D3, also known as Protein kinase C nu type, Protein kinase EPK2, PRKD3, EPK2 and PRKCN, is a cytoplasm and membrane protein which belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family and PKD subfamily. PRKD3 / PRKCN contains one PH domain, two phorbol-ester/DAG-type zinc fingers and one protein kinase domain. Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. They also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role. PRKD3 / PRKCN converts transient diacylglycerol (DAG) signals into prolonged physiological effects, downstream of PKC. It is involved in resistance to oxidative stress. PRKD3 / PRKCN is activated by DAG and phorbol esters. Phorbol-ester/DAG-type domains 1 and 2 bind both DAG and phorbol ester with high affinity and mediate translocation to the cell membrane. Autophosphorylation of Ser-735 and phosphorylation of Ser-731 by PKC relieves auto-inhibition by the PH domain. PRKD3 / PRKCN can be activated rapidly by the agonists of G protein-coupled receptors. It resides in both cytoplasm and nucleus, and its nuclear accumulation is found to be dramatically enhanced in response to its activation. PRKD3 / PRKCN can also be activated after B-cell antigen receptor (BCR) engagement, which requires intact phospholipase C gamma and the involvement of other PKC family members.

Referenzen
  • Schultz SJ, et al.,1994, Cell Growth Differ. 4 (10): 821-30.
  • Hayashi A, et al., 1999, Biochim Biophys Acta 1450 (1): 99-106.
  • Mayne M, et al., 2000, J. Immunol. 164 (12): 6538-42.
  • Ali A, et al., 2002, Chem. Rev. 101 (8): 2527-40.
  • Size / Price
    Katalog: HG10665-UT
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“