After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mensch PDK-1 Gene ORF cDNA clone expression plasmid, N-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human PDK1 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:BC039158
cDNA-Größe:1311bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens pyruvate dehydrogenase kinase, isozyme 1 with N terminal His tag.
Synonyme für Gene:PDK1
Spezies:Human
Vektor:pCMV3-N-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Hintergrund

Pyruvate dehydrogenase kinase, isozyme 1, also known as [Pyruvate dehydrogenase [lipoamide]] kinase isozyme 1, mitochondrial and PDK1, is a member of the PDK / BCKDK protein kinase family. PDK-1 is expressed predominantly in the heart. It contains one histidine kinase domain. Pyruvate dehydrogenase kinase (PDK) isoforms are molecular switches that downregulate the pyruvate dehydrogenase complex (PDC) by reversible phosphorylation in mitochondria. An inhibitory effect of lipoic acid on PDKs would result in less phosphorylation of E1 and hence increased PDC activity. At least two isoenzymic forms of pyruvate dehydrogenase kinase ( PDK-1 and PDK-2 ) may be involved in the regulation of enzymatic activity of mammalian pyruvate dehydrogenase complex by phosphorylation. PDK-3 appears to have the highest specific activity among the three isoenzymes. PDK-1 inhibits the mitochondrial pyruvate dehydrogenase complex by phosphorylation of the E1 alpha subunit, thus contributing to the regulation of glucose metabolism.

Referenzen
  • Gudi R., et al., 1995, J. Biol. Chem. 270:28989-94.
  • Mooney,B.P. et al., 2000, Biochem Biophys Res Commun. 267 (2): 500 - 503.
  • Korotchkina,L.G. et al., 2004, Free Radic Res. 38 (10):1083-92.
  • Kato M., et al., 2007, Structure 15: 992-1004.
  • Size / Price
    Katalog: HG12312-NH
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“