Schnelle Bestellung

Mensch PC/pyruvate carboxylase Gene ORF cDNA clone expression plasmid, C-Myc tag

  • other Green fluorescent protein / GFP Gene Plasmid Map 5611
DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch PC Produktinformation zum cDNA-Klon
Gene_bank_ref_id:BC011617
cDNA-Größe:3582 bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens pyruvate carboxylase with C terminal Myc tag.
Synonyme für Gene:PCB
Spezies:Human
Vektor:pCMV3-C-Myc
Plasmid:pCMV3-PC-Myc
Restriktionsschnittstelle:KpnI + XbaI(6kb+3.58kb)
Tag-Sequenz:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PC qPCR primers for gene expression analysis, HP104234 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Size / Price
Katalog: HG15615-CM
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
VerfügbarkeitIn Stock
Zum Einkaufswagen hinzufügenAnfrage zu Großauftrag

Datasheet & Documentation

Contact Us
    Kürzlich angesehene Artikel
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“