After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mensch PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human PARP3 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_005485.4
cDNA-Größe:1602bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens poly (ADP-ribose) polymerase family, member 3, transcript variant 2.
Synonyme für Gene:IRT1, ADPRT3, ADPRTL2, ADPRTL3, PADPRT-3, PARP3
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:pCMV3-PARP3
Restriktionsschnittstelle:KpnI + XbaI (6.1kb + 1.6kb)
Tag-Sequenz:
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Human PARP3 Gene Plasmid Map
Human PARP3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Mensch PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid on other vectors
Mensch PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG11190-ACG$245
Mensch PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG11190-ACR$245
Mensch PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG11190-ANG$245
Mensch PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG11190-ANR$245
Mensch PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG11190-CF$215
Mensch PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His tagHG11190-CH$215
Mensch PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc tagHG11190-CM$215
Mensch PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tagHG11190-CY$215
Mensch PARP3 transcript variant 2 Gene ORF cDNA clone in cloning vectorHG11190-M$75
Mensch PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG11190-M-F$215
Mensch PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag tagHG11190-NF$215
Mensch PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His tagHG11190-NH$215
Mensch PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc tagHG11190-NM$215
Mensch PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA tagHG11190-NY$215
Mensch PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmidHG11190-UT$215
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Referenzen
  • Loseva O, et al. (2010) PARP-3 is a mono-ADP-ribosylase that activates PARP-1 in the absence of DNA. J Biol Chem. 285(11): 8054-60.
  • Lehtio L, et al. (2009) Structural basis for inhibitor specificity in human poly(ADP-ribose) polymerase-3. J Med Chem. 52(9): 3108-11.
  • Rouleau M, et al. (2009) Assessment of PARP-3 distribution in tissues of cynomolgous monkeys. J Histochem Cytochem. 57(7): 675-85.
  • Rouleau M, et al. (2007) PARP-3 associates with polycomb group bodies and with components of the DNA damage repair machinery. J Cell Biochem. 100(2): 385-401.
  • Augustin A, et al. (2003) PARP-3 localizes preferentially to the daughter centriole and interferes with the G1/S cell cycle progression. J Cell Sci. 116(Pt 8): 1551-62.
  • Size / Price
    Katalog: HG11190-UT
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    VerfügbarkeitIn Stock
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
    • Human PARP3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“