After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mensch PAH / PH Gene ORF cDNA clone expression plasmid, C-HA tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human PAH Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_000277.1
cDNA-Größe:1359bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens phenylalanine hydroxylase with C terminal HA tag.
Synonyme für Gene:PH, PKU, PKU1, PAH
Spezies:Human
Vektor:pCMV3-C-HA
Plasmid:pCMV3-PAH-HA
Restriktionsschnittstelle:KpnI + NotI (6kb + 1.4kb)
Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 696 A/G, 735 G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Human PAH Gene Plasmid Map
Human PAH natural ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Hintergrund

PAH (phenylalanine hydroxylase), also known as PH, belongs to the biopterin-dependent aromatic amino acid hydroxylase family. It contains 1 ACT domain, N-terminal region of PAH is thought to contain allosteric binding sites for phenylalanine and to constitute an "inhibitory" domain that regulates the activity of a catalytic domain in the C-terminal portion of the molecule. In humans, PAH is expressed both in the liver and the kidney, and there is some indication that it may be differentially regulated in these tissues. PAH catalyzes the hydroxylation of the aromatic side-chain of phenylalanine to generate tyrosine. It is one of three members of the pterin-dependent amino acid hydroxylases, a class of monooxygenase that uses tetrahydrobiopterin and a non-heme iron for catalysis. Defects in PAH are the cause of phenylketonuria (PKU). PKU is an autosomal recessive inborn error of phenylalanine metabolism, due to severe phenylalanine hydroxylase deficiency. It is characterized by blood concentrations of phenylalanine persistently above 1200 mumol.

Referenzen
  • Fitzpatrick PF, et al. (1999) Tetrahydropterin-dependent amino acid hydroxylases. Annu Rev Biochem. 68:355-81.
  • Olsson E, et al. (2011) Formation of the iron-oxo hydroxylating species in the catalytic cycle of aromatic amino acid hydroxylases. Chemistry. 17(13):3746-58.
  • Bassan A, et al. (2003) Mechanism of aromatic hydroxylation by an activated FeIVO core in tetrahydrobiopterin-dependent hydroxylases. Chemistry. 9(17):4055-67.
  • Panay AJ, et al. (2011) Evidence for a high-spin Fe(IV) species in the catalytic cycle of a bacterial phenylalanine hydroxylase. Biochemistry. 50(11):1928-33.
  • Bassan A, et al. (2003) Mechanism of dioxygen cleavage in tetrahydrobiopterin-dependent amino acid hydroxylases. Chemistry. 9(1):106-15.
  • Size / Price
    Katalog: HG12081-CY
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    VerfügbarkeitIn Stock
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
    • Human PAH natural ORF mammalian expression plasmid, C-HA tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“