Schnelle Bestellung

Mensch NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Mensch NPM1 Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:NM_002520
    cDNA-Größe:885bp
    cDNA-Beschreibung:Full length Clone DNA of Homo sapiens nucleophosmin (nucleolar phosphoprotein B23, numatrin) with C terminal HA tag.
    Synonyme für Gene:B23, NPM
    Spezies:Human
    Vektor:pCMV3-C-HA
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NPM1 qPCR primers for gene expression analysis, HP101603 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Mensch NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tag on other vectors
    Mensch NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG12074-ACG$225
    Mensch NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG12074-ACR$225
    Mensch NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG12074-ANG$225
    Mensch NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG12074-ANR$225
    Mensch NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG12074-CF$195
    Mensch NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG12074-CH$195
    Mensch NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG12074-CM$195
    Mensch NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG12074-CY$195
    Mensch NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone in cloning vectorHG12074-G$75
    Mensch NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG12074-NF$195
    Mensch NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG12074-NH$195
    Mensch NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG12074-NM$195
    Mensch NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG12074-NY$195
    Mensch NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmidHG12074-UT$195
     Erfahren Sie mehr über Expressionsvektoren
    Product nameProduct name
    Hintergrund

    Nucleophosmin 1 (NPM1), also known as nucleolar phosphoprotein B23 or numatrin, is a member of the nucleoplasmin family. Nucleophosmin (NPM) is a nucleolar phosphoprotein that plays multiple roles in ribosome assembly and transport, cytoplasmic-nuclear trafficking, centrosome duplication and regulation of p53. The NPM1 gene is frequently involved in chromosomal translocation, mutation and deletion. Mutations of the NPM1 gene leading to the expression of a cytoplasmic mutant protein, NPMc+, are the most frequent genetic abnormalities found in acute myeloid leukemias. Acute myeloid leukemias (AML) with mutated NPM1 have distinct characteristics, including a significant association with a normal karyotype, involvement of different hematopoietic lineages, a specific gene-expression profile and clinically, a better response to induction therapy and a favorable prognosis. In addition, NPM1 is a crucial gene to consider in the context of the genetics and biology of cancer. NPM1 is frequently overexpressed, mutated, rearranged and deleted in human cancer. Traditionally regarded as a tumour marker and a putative proto-oncogene, it has now also been attributed with tumour-suppressor functions.

    Referenzen
  • Chen W, et al. (2006) Nucleophosmin gene mutations in acute myeloid leukemia. Arch Pathol Lab Med. 130(11): 1687-92.
  • Naoe T, et al. (2006) Nucleophosmin: a versatile molecule associated with hematological malignancies. Cancer Sci. 97(10): 963-9.
  • Grisendi S, et al. (2006) Nucleophosmin and cancer. Nat Rev Cancer. 6(7): 493-505.
  • Falini B, et al. (2007) Acute myeloid leukemia carrying cytoplasmic/mutated nucleophosmin (NPMc+ AML): biologic and clinical features. Blood. 109(3): 874-85.
  • Meani N, et al. (2009) Role of nucleophosmin in acute myeloid leukemia. Expert Rev Anticancer Ther. 9(9): 1283-94.
  • Size / Price
    Katalog: HG12074-CY
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“