NKG7 cDNA ORF Clone, Human, C-His tag

Cat: HG14162-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NKG7 Reagents
CRO Services
Product recommended

All NKG7 Reagents
NKG7 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
498 bp
Description
Full length Clone DNA of Human natural killer cell group 7 sequence with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NKG7 cDNA ORF Clone, Human, C-His tag Alternative Names
GIG1 cDNA ORF Clone, Human;GMP-17 cDNA ORF Clone, Human;p15-TIA-1 cDNA ORF Clone, Human
NKG7 Background Information
Full Name
natural killer cell granule protein 7

NKG7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NKG7 cDNA ORF Clone in Cloning Vector, Mouse MG53420-U
NKG7 cDNA ORF Clone, Mouse, untagged MG53420-UT
NKG7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53420-ACGLN
NKG7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53420-ACG
NKG7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53420-ACR
NKG7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53420-CF
NKG7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53420-NF
NKG7 cDNA ORF Clone, Mouse, C-His tag MG53420-CH
NKG7 cDNA ORF Clone, Mouse, N-His tag MG53420-NH
NKG7 cDNA ORF Clone, Mouse, C-HA tag MG53420-CY
NKG7 cDNA ORF Clone, Mouse, N-HA tag MG53420-NY
NKG7 cDNA ORF Clone, Mouse, C-Myc tag MG53420-CM
NKG7 cDNA ORF Clone, Mouse, N-Myc tag MG53420-NM

NKG7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NKG7 cDNA ORF Clone in Cloning Vector, Human HG14162-G
NKG7 cDNA ORF Clone, Human, untagged HG14162-UT
NKG7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14162-ACGLN
NKG7 cDNA ORF Clone, Human, C-GFPSpark® tag HG14162-ACG
NKG7 cDNA ORF Clone, Human, N-GFPSpark® tag HG14162-ANG
NKG7 cDNA ORF Clone, Human, C-OFPSpark® tag HG14162-ACR
NKG7 cDNA ORF Clone, Human, N-OFPSpark® tag HG14162-ANR
NKG7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14162-CF
NKG7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14162-NF
NKG7 cDNA ORF Clone, Human, N-His tag HG14162-NH
NKG7 cDNA ORF Clone, Human, C-HA tag HG14162-CY
NKG7 cDNA ORF Clone, Human, N-HA tag HG14162-NY
NKG7 cDNA ORF Clone, Human, C-Myc tag HG14162-CM
NKG7 cDNA ORF Clone, Human, N-Myc tag HG14162-NM
NKG7 qPCR Primer Pairs, Human HP102813
info info
添加购物车成功! 添加购物车失败!