After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human NCR3LG1 natural ORF mammalian expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human NCR3LG1 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001202439.2
cDNA-Größe:1365bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens natural killer cell cytotoxicity receptor 3 ligand 1.
Synonyme für Gene:B7H6, B7-H6, DKFZp686O24166
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:pCMV3-NCR3LG1
Restriktionsschnittstelle:KpnI + XbaI (6.1kb + 1.37kb)
Tag-Sequenz:
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Human NCR3LG1 Gene Plasmid Map
Human NCR3LG1 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Katalog: HG16140-UT
Listenpreis:   (Save )
Preis:      [How to order]
VerfügbarkeitIn StockAnweisungen für die Lieferung
Bilder
  • Human NCR3LG1 natural ORF mammalian expression plasmid
    Kürzlich angesehene Artikel
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“