Schnelle Bestellung

Mensch Alpha-galactosidase B Gene ORF cDNA clone expression plasmid, N-His tag

  • Human CNDP1 Gene Plasmid Map 5655
DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch NAGA Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_000262.2
cDNA-Größe:1278 bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens N-acetylgalactosaminidase, alpha with N terminal His tag.
Synonyme für Gene:GALB, D22S674, NAGA
Spezies:Human
Vektor:pCMV3-SP-N-His
Plasmid:pCMV3-SP-His-NAGA
Restriktionsschnittstelle:HindIII + NotI(6kb+1.28kb)
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 321G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with NAGA qPCR primers for gene expression analysis, HP102365 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Katalog: HG13686-NH
Listenpreis: 
Preis:      (You Save: )

Datasheet & Documentation

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“